Detection of the Dapsone gene resistance in Sudanese Leprosy patients diagnosed by PCR
DOI:
https://doi.org/10.14741/ijmcr/v.5.2.20Keywords:
Leprosy, Polymerase Chain Reaction, Dapsone Resistance, Sudanese PatientsAbstract
Leprosy is a chronic disfiguring infection. The conventional methods of diagnosis are not conclusive and most of the physicians rely on the clinical presentation of the patients. Long duration treatment and compliance of the patients is required to clear out the infection. Emergence of resistance in the antileprosy drugs is an extra problem. In this study we tried to compare the conventional methods of diagnosis (ZN stain) with the molecular method (PCR) and to look for the presence of resistance in the recovered strains in Sudanese Leprosy patients. Ninety-one suspected leprosy patients were included in the study. ZN-stained Slit skin smears and PCR using the primers S13 (CTCCACCTGGACCGGCGAT) and S62 (GACTAGCCTGCCAAGTCG) was done for all specimens. All the positive specimens by PCR were further tested for the presence of the folpi resistant gene using the 2 other primers 5’ GCTTCTCGTGCCGA–AGCGCTCG - 3’and 5’AGCCGACATCAGTCGCCAGTGC 3’ to detect the resistance to dapsone. Out of the 91 suspected leprosy patients 32 (35.2%) were positive and 59 (64.8%) were negative by ZN stain. The PCR detected 50 (54.9%) as positive and 41 (45.1%) as negative. All the positive by the ZN stain were positive by the PCR. The resistance rate within the 50 positive samples by PCR was 10% (5 out of 50). Our results showed that The PCR method has better sensitivity in the diagnosis of the disease. The detection of the resistance gene to dapsone is emerging as a burden added to the difficulty of the treatment of the infected patients.
